Vacuolar ATPase C, Vacuolar ATPase C (genetic_marker) Citrus unshiu | Citrus Genome Database

Marker Overview

Marker Overview


Name	Vacuolar ATPase C
Genbank ID	AB036924
Type	gene marker
Species	Citrus unshiu
Primer 1	Vacuolar ATPase C.Forward Primer: AGGTATGGGAGCTGCGTATG
Primer 2	Vacuolar ATPase C.Reverse Primer: AACTCCCGCCATAACAACTG
Publication	[view all]
Contact	Ken Marsh

Contact

Name

Details

Ken Marsh

First name:	Ken
Last name:	Marsh
Title:	Researcher
Institution:	Mt. Albert Research Centre
Address:	Hort Research, Mt. Albert Research Centre, Private Bag 92 169, Auckland, New Zealand
Email:	kmarsh@hortresearch.co.nz
Phone:	+61 9 815 4200
Fax:	+61 9 815 4202

Publications


Year	Publication
2008	Ghasemnezhad M, Marsh K, Shilton R, Babalar M, Woolf A. Effect of hot water treatments on chilling injury and heat damage in 'satsuma' mandarins: Antioxidant enzymes and vacuolar ATPase, and pyrophosphatase. Postharvest biology and technology. 2008; 48(3):364-371.