C05811H06, C05811H06 (genetic_marker) Poncirus trifoliata | Citrus Genome Database

Marker Overview

Marker Overview


Name	C05811H06
Genbank ID	N/A
Type	gene marker
Species	Poncirus trifoliata
Primer 1	C05811H06.Forward Primer: GACGCTTGTGCTAATCGTCA
Primer 2	C05811H06.Reverse Primer: TCTCCGGCAAGTACTGATCC
Publication	[view all]
Contact	G. Ancillo

Contact

Name

Details

G. Ancillo

First name:	G.
Last name:	Ancillo
Title:	Researcher
Institution:	IVIA
Address:	Instituto Valenciano de Investigaciones Agrarias (IVIA), Carretera Moncada-Naquera, Km 4.5, E-46113 Moncada (Valencia), Spain
Country:	Spain
Email:	ancillo@ivia.es

Publications


Year	Publication
2010	Forner-Giner M, Llosá M, Carrasco J, Perez-Amador M, Navarro L, Ancillo G. Differential gene expression analysis provides new insights into the molecular basis of iron deficiency stress response in the citrus rootstock Poncirus trifoliata (L.) Raf. Journal of experimental botany. 2010; 61(2):483-490.