|
Marker Overview
Name | aCL1Contig13 |
Genbank ID | N/A |
Type | PCR marker |
Species | Citrus spp. |
Primer 1 | aCL1Contig13.Forward Primer: TCAGTGTTGCTATCTGGACGTGAC |
Primer 2 | aCL1Contig13.Reverse Primer: CGTTGATCTTTCTGTAGCGGG |
Product Length | 320 |
Publication | [view all] |
Contact | Ramon Serrano
|
Publications
Year | Publication |
2009 | Gimeno J, Gadea J, Forment J, Pérez-Valle J, Santiago J, Martínez-Godoy MA, Yenush L, Bellés JM, Brumós J, Colmenero-Flores JM, Talón M, Serrano R. Shared and novel molecular responses of mandarin to drought. Plant molecular biology. 2009; 70(4):403-420. |
|