Shiva A, Shiva A (genetic_marker) Poncirus trifoliata | Citrus Genome Database

Marker Overview

Marker Overview


Name	Shiva A
Genbank ID	N/A
Type	PCR marker
Species	Poncirus trifoliata
Primer 1	Shiva A.Forward Primer: GGTACCCTATTAACCCACAGC
Primer 2	Shiva A.Reverse Primer: CAGTGCGCAAGACGTGAC
Publication	[view all]
Contact	Shanchun Chen

Contact

Name

Details

Shanchun Chen

First name:	Shanchun
Last name:	Chen
Title:	Researcher
Institution:	Chinese Academy of Agricultural Sciences
Address:	Citrus Research Institute, Chinese Academy of Agricultural Sciences, Chongqing 400712, PR China
Email:	scchen2004@vip.sina.com

Publications


Year	Publication
2011	He Y, Chen S, Peng A, Zou X, Xu L, Lei T, Liu X, Yao L. Production and evaluation of transgenic sweet orange (Citrus sinensis Osbeck) containing bivalent antibacterial peptide genes (Shiva A and Cecropin B) via a novel Agrobacterium-mediated transformation of mature axillary buds. Scientia horticulturae. 2011; 128(2):99-107.