CitHistone H3, CitHistone H3 (genetic_marker) Citrus sinensis | Citrus Genome Database

Marker Overview

Marker Overview


Name	CitHistone H3
Genbank ID	N/A
Type	gene marker
Species	Citrus sinensis
Primer 1	CitHistone H3.Forward Primer: AGTTCCTAAGCCCTTTCACCC
Primer 2	CitHistone H3.Reverse Primer: GCGCTGTTGCTGCACTTC
Product Length	154
Publication	[view all]
Contact	Wen-Wu Guo

Contact

Name

Details

Wen-Wu Guo

First name:	Wen-Wu
Last name:	Guo
Title:	Researcher
Institution:	Huazhong Agricultural University
Address:	Key Laboratory of Horticultural Plant Biology (Ministry of Education), Huazhong Agricultural University, Wuhan 430070, China
Country:	China
Email:	guoww@mail.hzau.edu.cn
Phone:	+86 27 8728 1543
Fax:	+86 27 8728 0016

Publications


Year	Publication
2013	Liu Z, Ge X, Wu X, Kou S, Chai L, Guo W. Selection and validation of suitable reference genes for mRNA qRT-PCR analysis using somatic embryogenic cultures, floral and vegetative tissues in citrus. Plant cell, tissue and organ culture. 2013; 113(3):469-481.