HKT1.1, HKT1.1 (genetic_marker) Citrus spp. | Citrus Genome Database

Marker Overview

Marker Overview


Name	HKT1.1
Genbank ID	DY297409
Type	gene marker
Species	Citrus spp.
Primer 1	HKT1.1.Forward Primer: GTCCATGGAGAAAAAGAACC
Primer 2	HKT1.1.Reverse Primer: TGCTAGTGTCCGTGAAGAAG
Publication	[view all]
Contact	Patrick Ollitrault

Contact

Name

Details

Patrick Ollitrault

First name:	Patrick
Last name:	Ollitrault
Title:	Researcher
Institution:	CIRAD
Address:	Unite de Recherche Multiplication Vegetative, Centre de Cooperation Internationale en Recherche Agronomique pour le Developpement (CIRAD), Montpellier 34398, France
Country:	France
Email:	patrick.ollitrault@cirad.fr
Phone:	+33(0)467615971
Fax:	+33(0)467615666
Last update:	Jun 2020

Publications


Year	Publication
2013	Garcia-Lor A, Curk F, Snoussi-Trifa H, Morillon R, Ancillo G, Luro F, Navarro L, Ollitrault P. A nuclear phylogenetic analysis: SNPs, indels and SSRs deliver new insights into the relationships in the 'true citrus fruit trees' group (Citrinae, Rutaceae) and the origin of cultivated species. Annals of botany. 2013 Jan; 111(1):1-19.