|
Marker Overview
Name | IC0AAA56DH07 |
Genbank ID | DY282523 |
Type | gene marker |
Species | Citrus clementina |
Primer 1 | IC0AAA56DH07.Forward Primer: CCTTCCTCATCCACTTTTCAGG |
Primer 2 | IC0AAA56DH07.Reverse Primer: CTGAGACAGAAGCGCAAACTTG |
Publication | [view all] |
Contact | Fred Gmitter
|
Publications
Year | Publication |
2013 | Germana MA, Aleza P, Carrera E, Chen C, Chiancone B, Costantino G, Dambier D, Deng X, Federici CT, Froelicher Y, Guo W, Ibáñez V, Juárez J, Kwok K, Luro F, Machado MA, Naranjo MA, Navarro L, Ollitrault P, Ríos G, Roose ML, Talon M, Xu Q, Gmitter FG. Cytological and molecular characterization of three gametoclones of Citrus clementina. BMC plant biology. 2013; 13:129. |
|