|
Marker Overview
Name | Af1042 |
Genbank ID | CB610577 |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | Af1042.Forward Primer: CATCCAGTGCCGTGAATG |
Primer 2 | Af1042.Reverse Primer: ATATATTTGTCTATGGCGACT |
Product Length | 1200 |
Restriction Enzyme | Hinc2 |
Publication | [view all] |
Contact | Mitsuo Omura S. Ohta
|
Publications
Year | Publication |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2016 | Yin XR, Xie XL, Xia XJ, Yu JQ, Ferguson IB, Giovannoni JJ, Chen KS. Involvement of an ethylene response factor in chlorophyll degradation during citrus fruit degreening. The Plant journal : for cell and molecular biology. 2016 Apr 2. |
|