|
Marker Overview
Name | Bf0136a |
Genbank ID | DC885712 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Bf0136a.Forward Primer: ACACTGACTTCTTGCCATACA |
Primer 2 | Bf0136a.Reverse Primer: ACAGAATGTGACGGGAAAC |
Restriction Enzyme | HhaI |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Pinho-Ribeiro FA, Zarpelon AC, Mizokami SS, Borghi SM, Bordignon J, Silva RL, Cunha TM, Alves-Filho JC, Cunha FQ, Casagrande R, Verri WA. The citrus flavonone naringenin reduces lipopolysaccharide-induced inflammatory pain and leukocyte recruitment by inhibiting NF-κB activation. The Journal of nutritional biochemistry. 2016 Jul; 33:8-14. |
|