|
Marker Overview
Name | Ov0408 |
Genbank ID | AU186532 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Ov0408.Forward Primer: TGTATCGACGGTGGAGATTG |
Primer 2 | Ov0408.Reverse Primer: CACTGACGCTGCTTTAGGTTC |
Restriction Enzyme | DraI |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Chang SC, Deng WL, Huang HC, Chung KR, Tzeng KC. Differential expression of pectolytic enzyme genes in Xanthomonas citri subsp. citri and demonstration that pectate lyase Pel3 is required for the formation of citrus canker. Microbiological research. 2016 Nov; 192:1-10. |
|