|
Marker Overview
Name | Sz0018 |
Genbank ID | N/A |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Sz0018.Forward Primer: CCTGCCTCCGGTCCCT |
Primer 2 | Sz0018.Reverse Primer: GCCTCTATGTTGGACGCTTGG |
Restriction Enzyme | HindIII |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Niza B, Merfa MV, Alencar VC, Menegidio FB, Nunes LR, Machado MA, Takita MA, de Souza AA. Draft Genome Sequence of 11399, a Transformable Citrus-Pathogenic Strain of Xylella fastidiosa. Genome announcements. 2016 Oct 13; 4(5). |
|