|
Marker Overview
Name | Sz0026 |
Genbank ID | N/A |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Sz0026.Forward Primer: GAGCAGGAACCGGAATCACC |
Primer 2 | Sz0026.Reverse Primer: AAACAACAGGCCCTTACTCTT |
Restriction Enzyme | HaeIII |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Xiao C, Yao RX, Li F, Dai SM, Licciardello G, Catara A, Gentile A, Deng ZN. Population structure and diversity of citrus tristeza virus (CTV) isolates in Hunan province, China. Archives of virology. 2016 Oct 22. |
|