HAU21_Marker3698653

Marker Overview
NameHAU21_Marker3698653
Genbank IDN/A
TypeSLAF
SpeciesCitrus spp.
Publication[view all]
ContactJin-Zhi Zhang
Contact
NameDetails
Jin-Zhi Zhang
First name:Jin-Zhi
Last name:Zhang
Title:Researcher
Institution:Huazhong Agricultural University
Address:Key Laboratory of Horticultural Plant Biology (Ministry of Education), College of Horticulture and Forestry Science, Huazhong Agricultural University, Wuhan, China
Country:China
Email:jinzhizhang@mail.hzau.edu.cn
Phone:86-27-6201-8231
Fax:86-27-8728-2010
Last update:19 December 2018
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Marker3698653Marker3698653Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Clementine/Trifoliate-HAU21-F1-MaternalLG01N/A0.28Marker3698653View
Sequence
>HAU21_Marker3698653 ID=HAU21_Marker3698653|Name=HAU21_Marker3698653|organism=Citrus spp.|type=genetic_marker|length=632bp
TATATGATTAGTAGCACCAACTCTCCAATTAAATTGCTAAAAGACATCCA
CTGAGCTCGGAGGTTGATGTATTATATATTCATTACAAGTTACTAATATG
XXXXXXXXXXATGTGCTTATGACACCAGCAGACTTGATGCGAGCAATTGT
TCCTGTGTTTCCTCCATCTGAATCAACTCGAGTCAGAGAGGGATTCTTAA
GAGGCGAACG;TATATGATTAGTAGCACCAACTCTCCAATTAAATTGCTA
AAAGACATCCACTGAGCTCGGAGATTGATGTATTATATATTCATTACAAG
TTACTAATATGXXXXXXXXXXATGTGCTTATGACACCAGCAGACTTGATG
CGAGCAATTGTTCCTGTGTTTCCTCCATCTGAATCAACTCGAGTCAGAGA
GGGATTCTTAAGAGGCGAACG;TATATGATTAGTAGCACCAACTCTCTAA
TTAAATTGCTAATACACATCCACTGAGCTTGGAGATTGATGTATTATATA
TTCATTACAAGTTACTAATATGXXXXXXXXXXATGTGCTTATGACACCAG
CAGACTTGATGCGAGCAATTGTTCCTGTGTTTCCTCCATCTGAATCAACT
CGAGTCAGAGAGGGATTCTTAAGAGGCGAACG