FC875278

Overview
NameFC875278
Unique NameFC875278
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length743
Libraries
Library NameType
CTVClemen1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig11656 contig Ccv1_Contig11656:95..837. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC31402B10EF CTVClemen1 Citrus clementina cDNA clone C31402B10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875278 ID=FC875278|Name=FC875278|organism=Citrus clementina|type=EST|length=743bp
GCTAATTACTCTAATCATATCATCATCACCACCACGACCACCACCATCAG
GCGATCATGAGCCGACCAATTCACAGCCGTCTATTTTAGTGTTTTCTAGA
ACAAGATAAAAAGAGATGATGGCAAAAAATCTAGAAGCAACGATCAACGT
CACCACGGCGTCCGAGAGCTTCTCCGTCTCCTTACCGCCAATCGCCGAAC
TTCCGTTTCCCGTCAAAAGCATTGGCGGGAACGAGAGCGTAAGGCAATGC
CACGGGGTCTTATACGACGCCGCGTTGGTGGTCCCCACAGTGCTGTTCGT
GCTTTACCTGGTGGTTCACGCGAAGAAGAATTTGACGAAACTGTGTAACG
GGAGATCGTATATTATGATTTCCTATTATGCCCTTCTTTGGCTCGCTTGT
GTTCTCAATCTCGCTTGGTGTTCTCTTCAGGGTTGGCAGTGCTCTGCTGG
GAAGGAAGTTGCTTGGAACCTACTGTCATTATTTACAGTGGCTGCAGTGC
TGTATTTAGAAATCAGTTTGATGGCTTTTCTGCTCCAAGAAAGTTATGCT
AGTGGGTTGGAGACTTTAGCACGTACATTCATAATCTCAGGGATAATTGT
TGGTGTTGATATGCTTCTTAAGGTAATCTATGTCTTTGGATTTGGGTTTC
CATTGTTCATTGATGTGGATAGTACACATCGCATGAAGTGGGGCTTTTGG
ATAATCACGAATTTATACTTACTGCAGTTATGGGTCATCTTAT
back to top