FC875603

Overview
NameFC875603
Unique NameFC875603
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length699
Libraries
Library NameType
CTVClemen1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC31405G05EF CTVClemen1 Citrus clementina cDNA clone C31405G05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC875603 ID=FC875603|Name=FC875603|organism=Citrus clementina|type=EST|length=699bp
ACACACACGCAGCGCAGCAACCCTCCTAAATTCAGAAAATTAAAAAAAAG
GCAAACTCAAAAACTCAAATATTTGCGGAAGAGAGAGATGCGGTCGTTGC
GATAAAGGCTTGGTCGAGTCGTTTCCCTTACTCTTTTGAAGGTCAGAGAT
TTTGAACAAAACGACATCATCAATAGAGTCGTCTGCGCCAATACTATGCC
GTTTTATCTGTCATACAACTTCACCGACTCTTCTCTGATCCTTCCATGCC
TTTCGATGTTCTGTAGCCGCTTCTAGGCTTGCTTTTTTTTTTTTCCCTTT
TTTCCCTTCGGGCTTGAGAGCCATGCCAACTTTTACTGCTCTAGCTTTGG
ATAGGCTGATAGAACCTAGAGATTCCAAATCTGTCGACATGCCAGTTCCC
AATTCAAAACCTCCTCTTAAATCAAAATCTGGTCCTAATCCTAATTCCAA
GCTGCAAAGGAGAAATAGTGCTTCAGCGGCTGCGGATAGGAAAATGGAGA
GGAAAGTTAACCGCCCTCAGATTACCCCTGCACTCTATGCCACTCCAGAG
ACAACTCCACTTCCTGATTCACCGTCGTCGTTCCCTCCTTCTCCTTACAT
TATCAATCACAAGCGGCGTGGGCCACGGCTTTTGAAAAGTTTCTCTCAGG
CTGATGTGGCCTCTTGCAACAGGAGATGGATGAAGGAGAGGTTGATGGG
back to top