FC876178

Overview
NameFC876178
Unique NameFC876178
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length692
Libraries
Library NameType
DevOvary1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig4539 contig Ccv1_Contig4539:42..733. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32001C04EF DevOvary1 Citrus clementina cDNA clone C32001C04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876178 ID=FC876178|Name=FC876178|organism=Citrus clementina|type=EST|length=692bp
GGCTCTCACAAATTAACAAAAATCGCTTCTGTTTAAGCTGTGTTTGGCGT
TTATCTTTTAAAAATAAGCATATTGTATGGTAGAAGCTGATCATGTTATT
TTGAGCTGAATTGAGCTGAGGAAGGAAAAACAAAACAAAATCAAAAACTG
TGTATTAGAAGAAGGAAATAAAGGAAACGACGTCGTGATGGTGATGAAAG
AAAGAGATGAAGAGCTGGCTTTGTTTCTTGAAATGAGAAGACGAGAGAAG
GAGAAGACTAACCTTCTACTTCCTCTTAACTCCGACAACCACAATGCTCC
TTCAGGAACAAACGACGGAGGATCTCCGATATCAAAGATTGTGTCGTCCG
TTCCGATACGCAAGACCGCTGCTGAAAATTTCTTGAATTCGGAGAGTGAA
AACGATAAATCTGATTATGATTGGCTTCTTACACCACCGGGTACCCCACT
TTTTCCTTCCTTGGAGATGGAATCACAAAAAGCCAAACTGAATCAGATGG
AGATGCCTAATGCTCGTCCAACTGCTCTGAAAACAAGGCTGGCAAATGTT
CAGGAAGATCCTGCTTCGAGGGGTAGTGTCCTTTCTAAGAATCCCAATTT
GCCTTCTAGGGTGAACTCTTCCAGTACTGGTGACAGCAGGCCATCATCTT
CTGGTGGACGAACATCTAGTGCTAGAGCTGCTACACCAACTG
back to top