FC876319

Overview
NameFC876319
Unique NameFC876319
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length662
Libraries
Library NameType
DevOvary1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionC32003C11EF DevOvary1 Citrus clementina cDNA clone C32003C11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC876319 ID=FC876319|Name=FC876319|organism=Citrus clementina|type=EST|length=662bp
GATCGCGAACTCGAGCCTCAAGTCCCAACTCTGGACCCTAGAAAAGAGAG
AACACCAGAAAATGGCGCTGCGCACGTGTCAAAATTTCGCTTCTCCTTTC
GTTAGTTCAATCAAATTGACTAAAAAACCCATTCGAAACTTCAAAGCTCC
AGTTAAAAATTGCCAGTCAGACCCAAATGAATCGCGTAAGCTGGTTTTGC
AAGTAAAGGAGAGGCTTGAAAAAGACTATAACAGTCTCCCAGTTGGTAAA
AATGGTAGAGATGATGAAGATATGATCCTCTGGTTTTTAAAGGATCGAAA
GTTCTCTATCGAAGAATCTCTAGCAAAATTGACTAAGGCCATTAAATGGC
GTCAAGAATTTAGAGTGTCTGAACTGAACGAAGACTCTGTAAGAGGTATT
GCTGAATCAGGAAAAGCGTATGTGCATGACTTTCTGGACATAAATGAAAG
ACCAGTGCTCATAGTGGTGGCATCAAAGCACTTGCCTGCAGTGAGTTTTG
AGTTGCAGAATACCCTCTTTTACTGCTTATGTCTTTGGTTGAATTTGTTT
TATGGTTCCAATCAGCATCTCCTAGCCTCATGTGTAAATTATAATCACTC
TCTTGCAGATACATTAACTTCCTTAGTGGTTGGACAAGTACTTTAAAATC
TCAAGTCCTGTT
back to top