FC920173

Overview
NameFC920173
Unique NameFC920173
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length438
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14424 contig Ccv1_Contig14424:162..600. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32005A01EF RVDevelop1 Citrus clementina cDNA clone C32005A01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920173 ID=FC920173|Name=FC920173|organism=Citrus clementina|type=EST|length=438bp
TTGTTTCGTCACTCTTTCTCTTCTCATGTGTCATCTCTCTGTCGCTAGTC
AAAATGCCGACATCAAATTGCCACTCAGAGCTGTGAATCTTGGAAACTGG
CTTGTCACTGAAGGATGGATGAAACCTTCTCGCTTTGATGATATTCCCAA
CAAGGATCTTCTGGATGGAACTCAAGTTCAGTTCATGTCAACAAAGTTTC
AGAAGTATATTGCCGCTGAAAGCGCAGGTGGCACCATTGTTGTAGCCAAC
ACAACCTCACCTTCTGGCTGGGAAACTTTCAGGTTGTGGAGGGACAATCA
GACATTTTACAATTTCAGAGTGAACAATAAGCAGTTTATTGGACTGGAGA
ATCAAGGCCAAGGAAATGTTCTAGGAGCAGTTTCCAATACAGCTGGTTAC
TCCGAGACATTTCAGATTGTGAGGAAAGATGGCGATTC
back to top