FC920174

Overview
NameFC920174
Unique NameFC920174
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length115
Libraries
Library NameType
RVDevelop1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig14116 contig Ccv1_Contig14116:166..280. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32005A02EF RVDevelop1 Citrus clementina cDNA clone C32005A02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920174 ID=FC920174|Name=FC920174|organism=Citrus clementina|type=EST|length=115bp
GATTTTCCTACTACTCCTCTCCGTTTTTCTTCGGGGAGCTTCTTCATCAA
TCCTTTCCGAGGACACACCTATTAGCTTCTCATTTCCCTCATTCGCCAAA
GACAGGTGTGACAAT
back to top