FC920193

Overview
NameFC920193
Unique NameFC920193
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length693
Libraries
Library NameType
RVDevelop1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig15474 contig Ccv1_Contig15474:352..1044. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC32005C01EF RVDevelop1 Citrus clementina cDNA clone C32005C01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FC920193 ID=FC920193|Name=FC920193|organism=Citrus clementina|type=EST|length=693bp
CACTTCCAAGCATCTCTCCCTCCACTATGATCTTGAAGAACAGAATGCTT
TTGTTAAGTCCTCTTTCGATGTTGGTCCTAAGTTGCATTTCAGAGCTGCC
CACGATGTCAAGGCACAACAAGGAGAGGTGGGAGTCGTTGCAAACCTTGG
CGATCCTGGATATGCTCTGGAATTGTCGTCTCCAGTTCCCTATGTTGGTT
ATCCGAAGGCAACTTTTAAATTCCCCCTTGGCGAAGTTTCATTGGTGGAG
AGAGAAGAGGAAGAAGTGAAGAAAACATTGTCTATAAGTGGAATCGCTAA
AGGTCAGATTTTGAATGGGATCTGCACAGCTCAATACGAGGAGGAAGATT
TGAAACTAAGATACTGCTATAAGGATGAAGCTTTGTCATTTATTCCAACC
ATTTCACTTCCTTCAAATGCTCTATCATTTGCATTAAAGCGACAGTTTAG
TCCCTCTGATAAGTTGAGCTACTGGTACAATTTTGATTCCAACTACTGGA
GTGCAGTATACAAACACACATATGGCAAAGACTTTAAGTTCAAAGCTGGT
TATGATTCAGAGGTGCGACTAGGCTGGGCATCTCTTTGGGTTGGAGATGA
AGGCGGAAAGGCAAGGACAGCCCCGATGAAGATGAAAGTCCAATTCATGC
TCCAAGTGCCANCAGACGACATCAAATCCTCAGCGTTAATGTT
back to top