GH733243

Overview
NameGH733243
Unique NameGH733243
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length177
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig11069 contig Ccv1_Contig11069:346..522. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionU_22 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733243 ID=GH733243|Name=GH733243|organism=Citrus clementina|type=EST|length=177bp
GATGAGTCCTGAGTAAGTCACAGCCATTGGCAAAATAAACTTCAGCTAGG
CTTTCAGCAGCAAACCCAGGGAATTGTGATGCCAAAAACTCCACCGGATT
CATCTCAGTATCTTCTATCATTCCAATCTCACCGGTCATATCGTTCACGA
ACCCATGTCTAGAATTGGTACGCAGTC
back to top