GH733252

Overview
NameGH733252
Unique NameGH733252
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length194
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Properties
Property NameValue
Genbank descriptionU_35 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733252 ID=GH733252|Name=GH733252|organism=Citrus clementina|type=EST|length=194bp
GANACGCTTGAGGTTGAGCATTAGGTTTGGTTCTTTGGAGGTNATCCTGC
GGCAAATTCTTGAAGTCGAGCAGGCCATTTATGACGGGGAATGTCATCAA
ATGTGAACCAAGAAGCTGAAGATAGTTTTGTTGAGTGATCAGGGACTGGT
GGAGGCATTGATGGCTCTGGTTCTGTTACTCAGGACTCATCANN
back to top