GH733257

Overview
NameGH733257
Unique NameGH733257
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length164
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Properties
Property NameValue
Genbank descriptionU_42 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733257 ID=GH733257|Name=GH733257|organism=Citrus clementina|type=EST|length=164bp
GATGAGTCCTGAGTAAGGCCAACTACTGGCTATACTGACTACTTACTATT
GTTCTAGAGCGGGGAAAGTCTTCAAGAATGTAAAAACAAGTGCCGTCCCC
GATTCCTCTTATTGGAGAACTAGTCTAGTAGAAAGAATATTGACCGGCGA
ATTGGTACGCAGTC
back to top