BQ623121

Overview
NameBQ623121
Unique NameBQ623121
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length542
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1283 contig Csv1_Contig1283:141..679. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HSP11_SOYBN (17.3 kDa class I heat shock protein OS=Glycine max GN=HSP17.3-B PE=3 SV=1)

HSP 1 Score: 175.252 bits (443), Expect = 1.699e-43
Identity = 93/132 (70.45%), Postives = 97/132 (73.48%), Query Frame = 3
Query:   60 MSLIPSIFGNR--SVFDPFSSDVWAPL------GSSSNEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            MSLIPS FG R  SVFDPFS DVW P        S S E S F S +VDWKET EAHVFKAD+PGL          DGRVLQISGER+VEKEDKND WHRVER  GK VRRFRLPENAK+DQVKASMENGVL
Sbjct:    1 MSLIPSFFGGRRSSVFDPFSLDVWDPFKDFPFPSSLSAENSAFVSTRVDWKETPEAHVFKADIPGLKKEEVKLEIQDGRVLQISGERNVEKEDKNDTWHRVERSSGKLVRRFRLPENAKVDQVKASMENGVL 132          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HSP12_SOLPE (17.6 kDa class I heat shock protein OS=Solanum peruvianum PE=2 SV=1)

HSP 1 Score: 170.629 bits (431), Expect = 4.184e-42
Identity = 92/133 (69.17%), Postives = 102/133 (76.69%), Query Frame = 3
Query:   60 MSLIPSIFGNR---SVFDPFSSDVWAP---LG---SSSNEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            MSLIP IFG+R   SVFDPFS DV+ P   LG   S+S E S FA+ ++DWKET EAHVFKADLPGL          + RVLQISGER+VEKEDKND WHRVER  GKF+RRFRLPENAK+DQVKASMENGVL
Sbjct:    1 MSLIPRIFGDRRSTSVFDPFSIDVFDPFKELGFTVSNSGETSAFANTRIDWKETPEAHVFKADLPGLKKEEVKVEVEEDRVLQISGERNVEKEDKNDTWHRVERSSGKFMRRFRLPENAKMDQVKASMENGVL 133          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HSP11_SOLPE (17.7 kDa class I heat shock protein OS=Solanum peruvianum PE=2 SV=1)

HSP 1 Score: 169.088 bits (427), Expect = 1.217e-41
Identity = 88/133 (66.17%), Postives = 101/133 (75.94%), Query Frame = 3
Query:   60 MSLIPSIFGNR---SVFDPFSSDVWAPL------GSSSNEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            MSLIP IFG+R   S+FDPFS DV+ P       G++S E S FA+ ++DWKET EAHVFKADLPGL          + RVLQISGER++EKEDKNDKW RVER  GKF+RRFRLPENAK+DQVKASMENGVL
Sbjct:    1 MSLIPRIFGDRRSSSMFDPFSIDVFDPFRELGFPGTNSGETSAFANTRIDWKETPEAHVFKADLPGLKLEEVKVEVEEDRVLQISGERNMEKEDKNDKWQRVERSSGKFMRRFRLPENAKMDQVKASMENGVL 133          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HSP12_MEDSA (18.2 kDa class I heat shock protein OS=Medicago sativa GN=HSP18.2 PE=2 SV=1)

HSP 1 Score: 168.318 bits (425), Expect = 2.077e-41
Identity = 89/137 (64.96%), Postives = 97/137 (70.80%), Query Frame = 3
Query:   60 MSLIPSIFGNR--SVFDPFSSDVWAPL-----------GSSSNEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            MSLIPS FG R  +VFDPFS DVW P             S   E S F S +VDWKET EAHVFKADLPG+          D RVLQISGERSVEKEDKND+WHR+ER  GKF+RRFRLPENAK+DQVKA+MENGVL
Sbjct:    1 MSLIPSFFGGRRSNVFDPFSLDVWDPFKDFPFNNSALSASFPRENSAFVSTRVDWKETPEAHVFKADLPGMKKEEVKVEIEDDRVLQISGERSVEKEDKNDQWHRLERSSGKFMRRFRLPENAKMDQVKAAMENGVL 137          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HSP11_PEA (18.1 kDa class I heat shock protein OS=Pisum sativum GN=HSP18.1 PE=2 SV=1)

HSP 1 Score: 167.162 bits (422), Expect = 4.626e-41
Identity = 90/137 (65.69%), Postives = 96/137 (70.07%), Query Frame = 3
Query:   60 MSLIPSIFGNR--SVFDPFSSDVWAPL-----------GSSSNEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            MSLIPS F  R  +VFDPFS DVW PL            S   E   F S +VDWKET EAHVFKADLPGL          D RVLQISGERSVEKEDKND+WHRVER  GKF+RRFRLPENAK+D+VKASMENGVL
Sbjct:    1 MSLIPSFFSGRRSNVFDPFSLDVWDPLKDFPFSNSSPSASFPRENPAFVSTRVDWKETPEAHVFKADLPGLKKEEVKVEVEDDRVLQISGERSVEKEDKNDEWHRVERSSGKFLRRFRLPENAKMDKVKASMENGVL 137          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HSP14_SOYBN (17.5 kDa class I heat shock protein OS=Glycine max GN=HSP17.5-E PE=3 SV=1)

HSP 1 Score: 166.392 bits (420), Expect = 7.891e-41
Identity = 87/133 (65.41%), Postives = 95/133 (71.43%), Query Frame = 3
Query:   60 MSLIPSIFGNR--SVFDPFSSDVW-------APLGSSSNEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            MSLIP  FG R  +VFDPFS D+W        P  S S E S F S +VDWKET EAHVFKAD+PGL          D RVLQISGER+VEKEDKND WHRVER  GKF RRFRLPENAK+++VKASMENGVL
Sbjct:    1 MSLIPGFFGGRRSNVFDPFSLDMWDPFKDFHVPTSSVSAENSAFVSTRVDWKETPEAHVFKADIPGLKKEEVKVQIEDDRVLQISGERNVEKEDKNDTWHRVERSSGKFTRRFRLPENAKVNEVKASMENGVL 133          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HSP13_SOYBN (17.5 kDa class I heat shock protein OS=Glycine max GN=HSP17.5-M PE=3 SV=1)

HSP 1 Score: 166.007 bits (419), Expect = 1.031e-40
Identity = 87/132 (65.91%), Postives = 97/132 (73.48%), Query Frame = 3
Query:   60 MSLIPSIFGNR--SVFDPFSSDVWAPLG------SSSNEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            MSLIPSIFG R  +VFDPFS DVW P        S S E S F + +VDWKET EAHVF+AD+PGL          D RVLQISGER++EKEDKND WHRVER  G F+RRFRLPENAK++QVKASMENGVL
Sbjct:    1 MSLIPSIFGGRRSNVFDPFSLDVWDPFKDFHFPTSLSAENSAFVNTRVDWKETPEAHVFEADIPGLKKEEVKVQIEDDRVLQISGERNLEKEDKNDTWHRVERSSGNFMRRFRLPENAKVEQVKASMENGVL 132          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HSP11_SOLLC (17.8 kDa class I heat shock protein OS=Solanum lycopersicum PE=2 SV=1)

HSP 1 Score: 165.622 bits (418), Expect = 1.346e-40
Identity = 86/133 (64.66%), Postives = 99/133 (74.44%), Query Frame = 3
Query:   60 MSLIPSIFGNR---SVFDPFSSDVWAPL------GSSSNEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            MSLIP IFG+R   S+FDPFS DV+ P        ++S E S FA+ ++DWKET E HVFK DLPGL          + RVLQISGER+VEKEDKNDKWHR+ER  GKF+RRFRLPENAK+DQVKASMENGVL
Sbjct:    1 MSLIPRIFGDRRSSSMFDPFSIDVFDPFRELGFPSTNSGESSAFANTRIDWKETPEPHVFKVDLPGLKKEEVKVEVEEDRVLQISGERNVEKEDKNDKWHRMERSSGKFMRRFRLPENAKMDQVKASMENGVL 133          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HSP16_SOYBN (18.5 kDa class I heat shock protein OS=Glycine max GN=HSP18.5-C PE=3 SV=1)

HSP 1 Score: 164.851 bits (416), Expect = 2.296e-40
Identity = 89/140 (63.57%), Postives = 99/140 (70.71%), Query Frame = 3
Query:   60 MSLIPSIFGNR--SVFDPFSSDVWAP---------LGSSS-----NEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            MSLIP+ FG R  +VFDPFS DVW P         L S+S      E S F S +VDWKET EAHVFKAD+PGL          D +VLQISGER+VEKEDKND WHRVER  GKF+RRFRLPENAK++QVKASMENGVL
Sbjct:    1 MSLIPNFFGGRRNNVFDPFSLDVWDPFKDFPFPNTLSSASFPEFSRENSAFVSTRVDWKETPEAHVFKADIPGLKKEEVKVQIEDDKVLQISGERNVEKEDKNDTWHRVERSSGKFMRRFRLPENAKVEQVKASMENGVL 140          
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Match: HS181_ARATH (18.1 kDa class I heat shock protein OS=Arabidopsis thaliana GN=HSP18.1 PE=2 SV=1)

HSP 1 Score: 164.466 bits (415), Expect = 2.999e-40
Identity = 85/138 (61.59%), Postives = 99/138 (71.74%), Query Frame = 3
Query:   60 MSLIPSIFGNR--SVFDPFSSDVWAPL------------GSSSNEVSTFASAQVDWKETREAHVFKADLPGLXXXXXXXXXXDGRVLQISGERSVEKEDKNDKWHRVERGRGKFVRRFRLPENAKIDQVKASMENGVL 431
            MSLIPSIFG R  +VFDPFS D+W P              S++ +V+ F +A+VDWKET EAHVFKADLPGL          D  VLQISGERS E E+KNDKWHRVER  GKF+RRFRLPENAK+++VKA+MENGVL
Sbjct:    1 MSLIPSIFGGRRSNVFDPFSQDLWDPFEGFFTPSSALANASTARDVAAFTNARVDWKETPEAHVFKADLPGLKKEEVKVEVEDKNVLQISGERSKENEEKNDKWHRVERASGKFMRRFRLPENAKMEEVKATMENGVL 138          
The following BLAST results are available for this feature:
BLAST of BQ623121 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 50
Match NameE-valueIdentityDescription
HSP11_SOYBN1.699e-4370.4517.3 kDa class I heat shock protein OS=Glycine max... [more]
HSP12_SOLPE4.184e-4269.1717.6 kDa class I heat shock protein OS=Solanum per... [more]
HSP11_SOLPE1.217e-4166.1717.7 kDa class I heat shock protein OS=Solanum per... [more]
HSP12_MEDSA2.077e-4164.9618.2 kDa class I heat shock protein OS=Medicago sa... [more]
HSP11_PEA4.626e-4165.6918.1 kDa class I heat shock protein OS=Pisum sativ... [more]
HSP14_SOYBN7.891e-4165.4117.5 kDa class I heat shock protein OS=Glycine max... [more]
HSP13_SOYBN1.031e-4065.9117.5 kDa class I heat shock protein OS=Glycine max... [more]
HSP11_SOLLC1.346e-4064.6617.8 kDa class I heat shock protein OS=Solanum lyc... [more]
HSP16_SOYBN2.296e-4063.5718.5 kDa class I heat shock protein OS=Glycine max... [more]
HS181_ARATH2.999e-4061.5918.1 kDa class I heat shock protein OS=Arabidopsis... [more]

Pages

back to top
Properties
Property NameValue
Genbank descriptionUSDA-FP_00212 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00212 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623121 ID=BQ623121|Name=BQ623121|organism=Citrus sinensis|type=EST|length=542bp
CAATTGATAAATAAGCAAACGCTTTCGAAGAAAGTGCTCGTCGCTTTGAT
TAAGCAAAAATGTCTTTGATTCCATCTATATTCGGAAACAGGAGCGTGTT
CGACCCATTTTCCTCGGACGTCTGGGCGCCCCTTGGCTCCTCCAGCAACG
AGGTGTCAACATTCGCCAGTGCTCAAGTCGATTGGAAAGAAACCCGGGAA
GCTCATGTTTTCAAGGCGGATCTTCCGGGGCTCAAGAAAGAGGAAGTGAA
GGTTGAAGTTGAGGACGGGAGAGTCCTTCAGATCAGCGGTGAGAGGAGCG
TCGAGAAGGAAGACAAGAACGACAAATGGCACCGTGTTGAGAGGGGCCGC
GGCAAGTTCGTGAGGAGGTTCCGGTTGCCTGAGAATGCCAAGATCGATCA
AGTTAAGGCATCAATGGAGAATGGTGTCCTCACCGTCACTGTTCCCAAAG
TGGAGGAGAAGAAGCCTGAGGTCAAAATCCATTTCAGATCACCTGGTTGA
AACTCTCCGTTAATTGCAGCCTTTTTAATTTGGTTCTTGTTT
back to top