BQ623132

Overview
NameBQ623132
Unique NameBQ623132
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length565
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00223 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00223 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623132 ID=BQ623132|Name=BQ623132|organism=Citrus sinensis|type=EST|length=565bp
CCTCGTGCCGGAAAACACATACTTGTGCTCACCAAAATTCTGATTTCCGG
GAAATAAATTCTTTCATCGCCTAGCAATAATGAAGAAATGTGGACTCTTT
GCAGCCTCAGTTGCTGCAGCTTCTGCTACAGCTATCTCTGATTCTTCCAC
CGCAAACTTAGCTTGCAATTCAAATTTTCAAGCTTCCCATGAGGATGTTT
CGTCAAAGAAAGATCATGAGAATTCAACAAAAGGATCATCATCAACAGAA
AAATTTGCTCCAAGATTTGATGGGTTGAGGTTTATTGAGACTCTGGTCAC
TGCTCACAGATGAGAAACAAGAGTTTTTTTTTTTTAATTTTTAATTTTTC
TGCTGGATTTTTAAAGAGGAGAGAAAAAATTTGTAATTTTTCACGCTCTG
TAATAGTAGTTTCACTGAGTAAATTGACCATTTGAGAAGTTTCTTTTATG
CTTTGATAACATTTTGATATGCTTTGGTACATTTTGGATCAAAGATGTAA
AATGCGTGTCTCATAGGAATCCTTAATATAAGCTGCCTTTCATATTTAAA
AAAAAAAAAAAGATA
back to top