BQ623134

Overview
NameBQ623134
Unique NameBQ623134
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length546
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Properties
Property NameValue
Genbank descriptionUSDA-FP_00225 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00225 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623134 ID=BQ623134|Name=BQ623134|organism=Citrus sinensis|type=EST|length=546bp
GACGACTAAAGCTTGAGGGCAAAGTACCAAAGAGATCAGTTCCAAGGTTG
TTCCGATAACTGCAAATATTCTGATTTCTTATTATTTAGCTAGAGAGTTC
ATTTCTCAGCAGCTGATTGGGTAAAAAGATTATGCACCTCGGTTCCAAAC
AGGTCCTAAAACTCCAATATTCAAATCCTTTTTTGCTCTTGCATGCTTGT
AATGCTGTCTAGCATCACCGGGTTATTTTTCAACATACAATCTAGAACGG
CAAAAGCAAAACGACGAAGACGGCTGAGAAGTAGAAGATATATGTTGCTT
TGCAAGGCTGAAAATAATGTATATGCAGCCCTTCCTCCCTGAAATGGGGG
ATTGTGATGTTGCAGTTAGTGGATTGTTCTTGTAATTGTGTGGCTCAAGA
ATTTTGCACTGAGATGTGAAGTTAAATGAAGCAGCAAACAGCTGTCGTTT
TGTCCTCTTTCTTTGTCATATGATTTGTATATGTGATCTTTTTTGTTATA
TAAACGTGAACTTTATGCCCAAAAAAAAAAAAAAAAAAAAAAACTC
back to top