CB304382

Overview
NameCB304382
Unique NameCB304382
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length578
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
BLAST: Citrus ESTs to SwissProt2010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2227 contig Csv1_Contig2227:639..1216. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Homology
BLAST of CB304382 vs. ExPASy Swiss-Prot
Match: Y2446_ARATH (Uncharacterized protein At2g34460, chloroplastic OS=Arabidopsis thaliana GN=At2g34460 PE=1 SV=1)

HSP 1 Score: 207.608 bits (527), Expect = 3.559e-53
Identity = 98/123 (79.67%), Postives = 117/123 (95.12%), Query Frame = -2
Query:  209 FILISSILVNGAAMGQILNPAYIFLNVFGLTLIAKLQAEQYIRKSGINYTIIRPGGLRNEPPTGNIIMETEDTLYEGTISRDQVAEVAVEALLHPESSYKVVEIISRVDAPKRSYEDLFGSIK 577
            F+L+SSILVNGAAMGQILNPAY+FLN+FGLTL+AKLQAE+YI+KSGINYTI+RPGGL+N+PPTGN++ME EDTLYEG+ISRD VAEVAVEALL  ESS+KVVEI++R +APKRSY+DLF S+K
Sbjct:  156 FVLVSSILVNGAAMGQILNPAYLFLNLFGLTLVAKLQAEKYIKKSGINYTIVRPGGLKNDPPTGNVVMEPEDTLYEGSISRDLVAEVAVEALLQEESSFKVVEIVARAEAPKRSYKDLFASVK 278          
The following BLAST results are available for this feature:
BLAST of CB304382 vs. ExPASy Swiss-Prot
Analysis Date: 2010-05-10 (BLAST: Citrus ESTs to SwissProt)
Total hits: 1
Match NameE-valueIdentityDescription
Y2446_ARATH3.559e-5379.67Uncharacterized protein At2g34460, chloroplastic O... [more]
back to top
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIIaR_A07 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIIaR_A07 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304382 ID=CB304382|Name=CB304382|organism=Citrus sinensis|type=EST|length=578bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCTTGGCAGACAAATCACTGG
CCATAGAATACTCGAAAGAAATCTTAATCAGAGCATTCAGCATATGAAAG
ATGAGGTTGGAATGCTATTTCGTATGTTACCAACCCAAAAAAAATAATAA
TAAAAATAAAAATATCACTAGCCTCTGCATATTTATTTTGATTATGAAGT
CATCGTTGCTTTATGGAACCAAAAAGATCCTCATATGAACGCTTAGGAGC
ATCCACACGAGAAATGATCTCCACAACTTTGTAAGATGATTCGGGATGAA
GTAGTGCCTCAACAGCAACTTCTGCGACCTGATCTCTGGAAATGGTACCT
TCATAAAGAGTATCTTCTGTCTCCATGATAATGTTTCCAGTTGGGGGTTC
ATTTCTCAATCCACCAGGCCTTATGATCGTGTAGTTAATACCAGATTTCC
TGATGTATTGCTCTGCCTGAAGCTTTGCTATTAAGGTGAGGCCAAACACA
TTCAGAAAAATGTAAGCTGGATTTAGTATTTGCCCCATTGCAGCTCCATT
GACTAAAATGGAGCTAATAAGAATGAAT
back to top