CB304389

Overview
NameCB304389
Unique NameCB304389
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length651
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11084 contig Csv1_Contig11084:293..943. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIIaR_B05 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIIaR_B05 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304389 ID=CB304389|Name=CB304389|organism=Citrus sinensis|type=EST|length=651bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAAGAAAAGGAACACTTCTCT
TATAAAAAATAACCACTATATATAAGAGTAACTCTTCAGGGTAAAAATCA
AATCCAACAAGAAAATTGAAAATTGATACAAGATTCAGTAGTGCATTATC
TATATATAACGGTGAAATATTCGCTGCTTATTAACCGTGAAGTTTGATTT
GGTCGTTGTTTATAACAGAAGTACATAACAGCATTCATTGACCGCCAAAA
TTCAGCTAAAGACGAGCTTCAGATTAACGAGGGACAAGAGCGCAGCCCAG
GCCACACAAGGTTTCATCAGATCACCAGCGATTGGATTCACCTCCTCGAC
CACTCGACAGTACCAAACCAAAGACCCAGACAAAGCCGTAGAAACAACCA
ACCCAGCCCAGTAGGCTCCTAAGTGGAACACAATGGGATCCCAAGCCAAG
CTCAGGCCGAGTTGAGCCAAACAAAGATACAAAACCGTGGGTTTCTTGTG
GAAGCCGCCTTCGGCCCAAACAAGCCAAGACGAGAGACCCATCAAGAAAG
TTGAAGCCAAGCTGGCCGTATGCAGCACCAACAAAGAAGGGAACCAGAAG
GGCTTTTCTTGCTTGACGTAGCGGTCACTTGACCCGTTGAAGTAAATGTT
T
back to top