CB304391

Overview
NameCB304391
Unique NameCB304391
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length651
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12563 contig Csv1_Contig12563:276..926. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIIaR_B08 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIIaR_B08 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304391 ID=CB304391|Name=CB304391|organism=Citrus sinensis|type=EST|length=651bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCAAAATTTCAATCTTCATA
GCTCAATAACCTCACACCAACAACACACACGGTTCTTTACAAAACAAAAC
ACAAAACGCAGAAGAAAGTAACATAGATTACATTACTAAGATTATGAAGC
TTCTGGTTTTAACCCTTTTATTGTATATTATACTTGAAAGGTGAAATCCC
AGATTATGCTTAATTTAATTTACATGGTTATTTCCCGAAAATGGATTTGA
TCCACCAAATGCCTTTGGGGTCCTGGGGGCTTTCTTCTGCCTCTGGGGGG
TTATCACTCTGTGGGGTTCTGTGCAGTTTGCTCACATCATACCCTTCACT
TGTAGCCTTCTCCACTAGCTGATTGTAGATCGCTTCATCCATATGAGGCT
CCCTGCATAAAATCCAGAGATATTTCCTGGTAGGCTCACCAATCAAAGCA
TACTGATAATTATCATCAATATACAAAACCCAGTAGTTGCCAACAACAGG
GATGATGGGGAAAAAGGGTGGCACATAAAACTTGACCTTCAACTTGGCCT
CATCGCTCTTAGGATCAGCCTTGTAAGCAGTGCCTTCGATGGACCCTCTT
TTGCCATCACTCCATGTCTCATTCCGCACATGCACTATCCCATCCTCATC
C
back to top