CB304397

Overview
NameCB304397
Unique NameCB304397
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length125
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIIaR_C03 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIIaR_C03 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304397 ID=CB304397|Name=CB304397|organism=Citrus sinensis|type=EST|length=125bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCCGTGGGCGGCGCCCTCGC
CGCCGCCGACACCGGGGATCTTCTGCTTGATCTTGTCCACCAAGCCCTCC
TTGTGTTCGCCCTCCTTGTGTTCCC
back to top