CB304401

Overview
NameCB304401
Unique NameCB304401
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length344
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig344 contig Csv1_Contig344:1..344. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIIaR_C10 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIIaR_C10 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304401 ID=CB304401|Name=CB304401|organism=Citrus sinensis|type=EST|length=344bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTGTAATGGGGTAGACTGG
AAATGAGGTAAGTGCTCAACAATCTCTCGGATGTCAACAACAACTTCCAA
TCCTCCGCATTTAGCAATCCTTTCTCAACTCTAACACTCAGCTTGTCACC
TATATCAACTTTCTTCTTCCAAGTCACGGATCTCCTTCAACCCGAATGAA
TTCGAGTTTTGCTGAAGGTCAACAGCAGTAACATCATTCAGCATTCTATT
AGTTCATGTAGCTCCATTTTGGCTAGCTTCGTCAAATTCGCAGAGACGGC
GGCTGGGTAACATTTCTCTGGATTTCAATGTGAAAAAGTGTCCC
back to top