CB305037

Overview
NameCB305037
Unique NameCB305037
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length557
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13178 contig Csv1_Contig13178:187..743. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0003_IVaR_B11 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0003_IVaR_B11 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB305037 ID=CB305037|Name=CB305037|organism=Citrus sinensis|type=EST|length=557bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATGGAGAACTAAAGAAGTCA
TTACCATTCATGGATGGCCAATTTATAGAGCATAGCCCCCAAAAACTTTC
ATGAACACGGCCAAATTTCAAGAACTAGGCCATAAACTACAATTAATAAC
AGAGCTAGGAATGGATCCAGCATGCATGAAGCATTTGAAAAATTTAAAAT
TTCAACATTATTATTCCCCGACACAAGTGTAATTGTGGGTTACACATGCT
ATTGAAATAATTTCTTGCATAGCAAGTGGATATCTGATTGAAGAGGAAGA
GCGAGTCCATTTTCTAGGATGTGTTGCTCACACACTTATTTATGAATTGA
TAACGGCGTATAAGTTATTCTTCGACTCTTTCTCAGCCCCTTGAACAGTA
TTTTCTGCAACATGATTTCTATCAAATCACAAAGGCACATTTTGTGATTT
GGTAGTTGCTGAGGTCCGACCTTTCAGAAGCCATTTTCTGCAACATGATT
TCTGAAATTGCATGTAATATGATAAATTGCTAGATGCTAAGCTTGTACCT
AGCATTG
back to top