CB305056

Overview
NameCB305056
Unique NameCB305056
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length215
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2728 contig Csv1_Contig2728:1079..1292. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0003_IVaR_E01 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0003_IVaR_E01 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB305056 ID=CB305056|Name=CB305056|organism=Citrus sinensis|type=EST|length=215bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGCTAAGTTCCATTTATTGTA
ATAACTTGGAGCACAACTAAAACAACGTAAAAATCACACGCTTGCAATAG
GCACATATTTTTGGATATTTTAATTGGGATGTTAAGTTACGACAAATGTA
ACTTAACAAAAACCCCACCATTAATCGGATAATCAACTATTTATGGATTA
AAAAATTGATAATTG
back to top