CF832033

Overview
NameCF832033
Unique NameCF832033
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length304
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13603 contig Csv1_Contig13603:1135..1438. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_01D06_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01D06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832033 ID=CF832033|Name=CF832033|organism=Citrus sinensis|type=EST|length=304bp
CGCAATTCGTATGATGAATTCAGTGATGTTGATGATCATGATGATGATCT
GAGCCCTAAGAAGATGGGATATGAGAAGATGGCATATGAGAAGATTCCAT
CTAAGGAAGCTGCGTGAGGTGGTGTTTTATTCTAAATAATTAATTAAGCC
TAATATTTGTGTAATTGTGTACTGTGTTCTTATTTTCATTTGATGATTTC
ACTGCGTTTATAATGTGGATTATGATCATTATCATTCGAACAAAGTTCTG
CTTTGTGGTCTGTACTTATAAAGCTGTTATATGTCTCTAAAAAAAAAAAA
AAAA
back to top