CF835308

Overview
NameCF835308
Unique NameCF835308
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length616
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Properties
Property NameValue
Genbank descriptionUCRCS02_06P24_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06P24, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF835308 ID=CF835308|Name=CF835308|organism=Citrus sinensis|type=EST|length=616bp
CAACATTATACGTTTAAGGAGGCAGNTTTTTGTGTTTTTTTAATATTTAA
TCCTTTTGAGGGGGGAAAATTTCCCAACAGACAAGCATTATGTCTAAAGA
CCTTATCTGTTTCAAGAGGGAGAAATAACAACGATGCGGACAATGTGATT
TCTTTTGCAAAAAAGAGAAAAAAAAACCTGAAAGGAAAAGTCAGGCCCTA
GTTTTTTAAGCAAGGGAGCTCTGAAATTTTGAGATCTCTCTCGCTCTTGC
TCTCTCTCATAGATCTTGAGCTCAGTTTTGTGAAATTGGTCTGAAAGGGA
CTCCTGGTTTTTGGCTTTTGAAAGCAGCCTTTTGTCTGGGTAATTTGCCA
CTTTTGCATATAAGGTTTTGAGCTGGTTTTTGGATATAAATGGACTGCAA
AAAGTTCATCCAGTTGGTCGAGGAGAAAAAGAAAAGAGCTTTGGAGAGGA
AAGAACCCCCTTTGAAGTGGGAGCAGAAGCTAAAAGCTGCTGCGAAGGCA
AAGGCTGATGCTGAAGCCAAGGCAAGGAAGTCTAAAACTGCAAAGCGTAA
AAGAAGATCTGTGTCTGATTCTGGCGCTGACAGTGATAGTGAGAGCAGTG
ATGTGGGTAGAAGGAA
back to top