CK933897

Overview
NameCK933897
Unique NameCK933897
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length791
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CK933897_ssr490 microsatellite CK933897_ssr490:490..499. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig1503 contig Csv1_Contig1503:52..842. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCGF1004543_H01 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10003_IIF_H01 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK933897 ID=CK933897|Name=CK933897|organism=Citrus sinensis|type=EST|length=791bp
GGGGAGCTGAAGAGACATCAAACCAAAGCTTCGTTATTTTTTTTTCTNNN
NNCAGCTTTTACCACTTAAATTATCAAAAGCCACTCTGCTTCCTCTGTTT
TTTGCATTTCTTTTCATTGTTTGTTAAGGAAGTATTGTACCTCACTTGAA
AGTTTTAAAATTTATTAAAGGGTTGTGCTTAGTCTGGCGATATATGATCT
GGGTTTTGTTTATTTTCTTGTTTTAGTTTTGGTTTATATTGGTGGTGATG
ATTGTTGATCGTCTAGGTTTGTGTTGTGATTAAACTGAGATCTGCTTTTA
CTCTGTTGTTTCTGGAATTTTCCTTGTTTTTTGGAAAGTTGAAAACTTTT
TTCAGATTCCTCAATTTGTGCTTGTCTGAAAAAGTTTTTGCTCATATTCC
AATCAAATGCCTTCTTGATTTGATGCTTCTTTTGTCATAGAAAAAAACGT
CCACTCCTCTGCATTTGCTATCCGGGTTCTCTATATTTCAGAGAGAGAGG
TCTTTTATCTGCTAAATTTTGTAAGCCATCTTTGTTATGCTAGCTAGATT
TTACTTCACTTGTACCGTCTAAAACGATGAGCCGAGGAATTGAAATCCTC
TCACCTGCCTCGTATCTTGAAAACTCCAACTGGTTGTTTCAAGAAAGCAA
GGGGACTAAATGGACCCCTCAAGAGAACAAGCAGTTTGAGAATGCTTTGG
CTGTGTATGATAAAGATACCCCTGATCGATGGATTAAGGTAGCAGCAATG
ATTCCAGGGAAGACGGTTGGTGATGTGATCAAACAATACAA
back to top