CK933902

Overview
NameCK933902
Unique NameCK933902
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length819
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CK933902_ssr76 microsatellite CK933902_ssr76:76..87. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig221 contig Csv1_Contig221:736..1556. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCGF1004543_H06 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10003_IIF_H06 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK933902 ID=CK933902|Name=CK933902|organism=Citrus sinensis|type=EST|length=819bp
GGGGAACTCAAAACAGCTGCTTGCTTGCACATGTGAAAGAGAGAGAAAAC
TATAAACACACATCTTAAATCCTTCTTAATTAATTAATAATATCTATTTA
CAGATTTTTGGATAGAAGACCACTTCTCAAATCTCAAGTGTGTTTTCAAC
GCTTTTTGTCTTAAAAAGGATTTTTAATATCTTTTGGTATATAATTTTTC
AGACAGTGCCTAAATCTAAATCCAACGGAATCCAAGGCGGGATGGAGTTC
TTTCACAACGCAAAAGCCGTGCGTCTACGTAGCCACCACGACAAGTTTCT
AATCGCCGAGGAAGATGAAGAGTCCGTTACCCAAGACCGTAACGGATCTT
CCAAGAGCGCTAAATGGACCGTGGAATCCGTTCCCGGATCCCAGAACATA
ATCCGTCTCAAGAGCTGTTACGGGAAGTACTTGACGGTTTCGAACCAGCC
GTTCCTGCTAGGGATGACTGGTCGGAAAGTGATTCAGTCAGTGCCCGGGA
GGCTTGATTCTTCTGTTGAGTGGGAACCCGTCAGGGAAGCCAATCAAGTG
AAGCTTAAGACGAGATACGGTCATTTCTTGAGAGCCAACGGGGGGTTGCC
ACCTTGGAGAAACTCTGTCACTCATGATATCCCTCATAGGACTGCTACTC
AAGATTGGATTTTGTGGGATGTCGATGTTGTTGAGATTCAAGTTCACTCT
CCATCTCCGTCTCCAACCGGTCAACAACAAGCTCCGCCTCCACCCTCTAT
TTCCCATTCCGATTCTTTAAACTCTTACTCCTCCTCACCTTCCTCTGTTC
CATCAATTCGGGCAAATTT
back to top