CK933917

Overview
NameCK933917
Unique NameCK933917
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length590
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Alignments
Feature NameTypeLocationAnalysis
CK933917_ssr13 microsatellite CK933917_ssr13:13..22.
CK933917_ssr67 microsatellite CK933917_ssr67:67..78.
Properties
Property NameValue
Genbank descriptionCGF1004543_F09 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10003_IIF_F09 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK933917 ID=CK933917|Name=CK933917|organism=Citrus sinensis|type=EST|length=590bp
GGGGATCTCTCATCTCTCTCTCAAGTCTCAACTCTCAAGAGTCAAGAAGA
CAAAAATAGAATAGTGACACACACACACGGTTGGACACATGCACACATTG
GAGAAGAAACTCAAGAAAGTGGTTGTGGCACCACCAAATGCAGCAAACCC
ATTCTACCCGCAATCACCACCGCCGACGCCAACCGGATCTGTTGCTTCCG
CCTACAAATCTGTTGCTACCGCCTACAGATCTACTGCTCCATGCCTCCAT
ATCACCAAGTTCCTCTGGACCCGGAAAGTGGCAACCCGAACCCGAATTTC
CCTTTAGAAATTTGCAGCTTCCAATTCAATGTTGTTGGTGGCTATGTATG
GTCGGAAATGGAAGTGGCAGTGATGGATGAGAAATGATGGCTGGCTCCTG
AGGTTCCGATCAATACCTTCCATTGCCGGTGATGTGGCGAGAATCAGAAA
AGGCTACCGGATCGGGTTCTCAGGTTCGGGTTGACCCCTTTCTCTCTTGT
GACTGGACTCTCTCTAACATTTACTGTTTAATTTTTAAATTATGTTCATG
ATAAATATTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top