CK934075

Overview
NameCK934075
Unique NameCK934075
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length382
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10290 contig Csv1_Contig10290:268..647. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCGF1004541_F04 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone P38DAB10001_IIIF_F04 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CK934075 ID=CK934075|Name=CK934075|organism=Citrus sinensis|type=EST|length=382bp
CGGCCGGGACAAAACAAACAGCAGCTACCTCAAAAAAAATAAACAAATGA
AGACTTCCTTAGTAACAACACTCTCCTTCCTTATACTTGCTTTGACCACA
AAACCTCAGTTGGGCGCCTCAGAATCTGAACCTATCTTAGATGTCTATGG
CAACCAGGTGGACTCCAGCCACAGGTATTATCTTGTCTCAGCACTCTGGG
GAGTTAAAACCGGCGGTGGAATTAGCGCGGACAAAGGCAAAAATGGACAG
TGTCCAACGGATGTTATCCAATTAAGTCCTAAGGACAAAAGGGGAAAGAA
TTTAGTTTTACTTCCGAATGACATTCCATAATTNNNNNNNAGTCCACTAA
TATTAAATTGAAATTTCTCAGAGTTCTTCTCT
back to top