|
Marker Overview
Name | NPF5.9 |
Genbank ID | N/A |
Type | SCAR |
Species | Citrus spp. |
Primer 1 | NPF5.9.Forward primer: GGCTCAAATTAAGCGTGTCC |
Primer 2 | NPF5.9.Reverse primer: TATTACCGAACAAGACGCTTAGGC |
Publication | [view all] |
Contact | Maria J. Asins
|
Publications
Year | Publication |
2023 | Asins MJ, Bullones A, Raga V, Romero-Aranda MR, Espinosa J, Triviño JC, Bernet GP, Traverso JA, Carbonell EA, Claros MG, Belver A. Combining Genetic and Transcriptomic Approaches to Identify Transporter-Coding Genes as Likely Responsible for a Repeatable Salt Tolerance QTL in Citrus.. International journal of molecular sciences. 2023 Oct 30; 24(21). |
|