EY659508

Overview
NameEY659508
Unique NameEY659508
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length467
Alignments
Feature NameTypeLocationAnalysis
EY659508_ssr341 microsatellite EY659508_ssr341:341..352.
Csv1_Contig13796 contig Csv1_Contig13796:984..1448. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-009-H07-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659508 ID=EY659508|Name=EY659508|organism=Citrus sinensis|type=EST|length=467bp
CCGGTNCCGGNATTACCGCCTCGACCCACGCGTCCGATGATTTATGCCAA
TGGCAATAAACTTCACGACACGTTCTAGCTAGCTAACAGCTGTATTAGCT
ACAACAAGTTAATAGCTCCAAATTTTTCTTCCTTGTTTCTTCTATGAGGA
AGAAAAGAGTGTGAGATGAGCTCCCAATAAGATGGTTTTTCTAGATCGGT
TTGTTTCCTGTGAGATGTTCGTATTACTGCTATTATGTTCCTTAGATGTA
CCGTCCAATGTTTAAGCCTAGGCTTTCCTTTTCCTCGATGGTGTGAGCTT
GATGTTATTAATATTCAGTAATGGCAGTGGTAGATGAGGGATGTATGTAT
GTATGCAGGGATGGTGTATGGTGCATGGATTTGTATAATGATGATAATTG
ATGATTCATGCCAATGGCAATAAACTTCANAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAA
back to top