EY659346

Overview
NameEY659346
Unique NameEY659346
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length613
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY659346_ssr570 microsatellite EY659346_ssr570:570..581. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig9487 contig Csv1_Contig9487:1015..1628. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-002-B07-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659346 ID=EY659346|Name=EY659346|organism=Citrus sinensis|type=EST|length=613bp
CCACGCGTCCGAGAAGACATCGCGGGCCCTAGCGATGGACCGAGGGATAA
GCATGGTGTCGATAAACGGAGGGCTGGTGATGGGTCCAGACGTCACGATC
TCGAATCCGTATCTAAAAGGAGCGGCCGAGATGTACGAAGATGGTGTGAT
GGCTTCGGTGGACCTGAGATTCTACGTTGATGCTCACATTTGCGTGTTCG
AAGACGTTTCATCGTACGGTCGTTATCTCTGCTTCAACCACGTCATCAAC
TGCAACGAAGACGCCATGAAGCTCGCCCGCATGCTATTGCCACCCTCCGA
CACTTCAACTCCTCCGCTAAGTTTTGAGGATACAAGAGTGCACCCACAGA
GAATAAGCAACAAGAAGCTGAACAAACTGATGGTAAATTTTGATGGCAAG
TTTCAAGCTGATTGCTCCGCGGACTAATATGGCAATTATGTAATTTATAA
TTTTGTTTAAATATTTAAGTTCTTTTCTTGTGTATGTTTTACACAAATTA
AGCTCTTATTGTTTCAAATGTTAAAAGCATAAGCTCTTATATTAAGGGTT
AAGCTTCTTTGATCTTTCGAAATAAATAAATTCAATAAAAAAAAAAGAGC
CTGAAATTTANGA
back to top