EY659077

Overview
NameEY659077
Unique NameEY659077
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length246
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig485 contig Csv1_Contig485:679..924. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-001-B05-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659077 ID=EY659077|Name=EY659077|organism=Citrus sinensis|type=EST|length=246bp
CCACGCGTCCGTGCTCAGCAAATTATGCTCATTCTTCAACAGATTTTGAC
ATCATTGGCAAAGACGAATATGGGTAAATATTTACCTTTTCCTTATGTAA
TCTTGTATCATTCGTTACAGTATCCGTGGATGTATTCAATTGTATAATTT
TGATCTATGGAACAAGAATATCATACATAATTTCTGATATTCCAACGGCC
ACAATTGGTTTTTCATTTCATTTGCTTATTTAAAAAAAAAAAAAAA
back to top