EY659072

Overview
NameEY659072
Unique NameEY659072
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length900
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
EY659072_ssr237 microsatellite EY659072_ssr237:237..250. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCS00-C1-101-001-A12-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659072 ID=EY659072|Name=EY659072|organism=Citrus sinensis|type=EST|length=900bp
CCACGCGTCCGTGAAAAGCAAAGGCCTAATGTGAATGTTGTTAATTGTTA
TGACAAAGATTACTCAGTGGTTACAATTACGAGTAAAGATAGGCCAAAGC
TTGTCTTTGATACAGTTTGCACTTTGACAGATATGCAGTATGTTGTTTTT
CACGCCAATATTGATGCTGAGGGACCAGAAGCATATCAGGAATACTTTAT
CAGGCATATAGATGGATCCCCTGTGAAATCGGATGCAGAGAGAGAGAGAG
TGATACAGTGTCTAAAAGCAGCTATTGAGAGAAGAGTTTCTGAGGGATTG
AAGCTAGAATTATGCACCACAGACAGAGTTGGACTGCTATCCAATGTTAC
ACGCATCTTCCGGGAAAATAGCCTCACGGTAACTAGAGCAGAAGTTGCAA
CTAAATTAGGCAAAGCTGTCAATACTTTCTATGTTGGTGGTGCATCCGGG
TATCCTGTTGATGCTAAAATAATTGATTCCATCCGACAGTCAATTGGCCA
GACTATACTTAAGGTGAAGGGCAACCCCGAAGACCTAAAACCAGCATCAC
AAGATTCTCCTACTAGATTCCTTTTTGGTGGTCTATTCAAGTCCAGATCT
TTTGTTAACTTTGGCTTGGTTAGATCCTGTTCCTGAGGAATGATGAACTT
TATTTAGCTCACCTCGATGTACATAGAAACCACCCCCACCTANGTTAATT
TCACAATATTCTTGCCTTTTACCNTTGATCTGACTGAAGAATAACTTAAA
CTTANGAGCCCTGTCATTTCTCAAAGGTGGTATATGGAAGAAAGCGTTGA
NGCAGCTCAAAGTCTTGTAAATCCCCCATTTGCCCCTTTAACATCTATTT
CTTTCTGAGATCCATCTGATGTTGAGACCTGAAGCAGAGAAGAATTATGT
back to top