DR405959

Overview
NameDR405959
Unique NameDR405959
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length544
Libraries
Library NameType
Mature Juice Sac from Navel Orange in pTriplEx2 vectorcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
DR405959_ssr183 microsatellite DR405959_ssr183:183..192. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionCSAJ-PNP1248E20 Mature Juice Sac from Navel Orange in pTriplEx2 vector Citrus sinensis cDNA clone CSAJ-PNP1248E20 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR405959 ID=DR405959|Name=DR405959|organism=Citrus sinensis|type=EST|length=544bp
GGGGGCGGCTTGTAAGCGCATTGAGAAACATGGCGGCTAATTGCGGTAGA
AGAACCCTACAAGTCGCTTCTGCTTCGGCTAAAACCCTTCTCAGCCGTTC
ATCTTCAGCTGCTCCAAAGTTGAGTGGACTAGCTTCCACCTCTAAGCCCA
CCTCTGCTTCTCGCTTGTCATCTCTTCACAAACTCTCTCTCTCCAGGGTT
CCTGTGGAGCTGGGTGGGGCGCTGTCTTTAATGCCTTTGCATAATGTTAC
TGCATCGGCCTTGTTCACATCGTTGCTGTCTTTGAACAATCAAAACTGGG
GCTGTCTATCAAAAGGATTTGCAACACCTCTATAGCGGGGTCTATAAACT
GCCAGCGTGTTGTACCTGCCAGAATTTCATCAACTCAAGAAAATGTTTTG
TCGGTTTTAGTTTGTGATTGAATGTAATGTCCAACTTCATAAAGAGATAG
CTATTATTTATTATTTCTTTTTTCTTCTTTTTTTCCTCCTAGTTAACCAT
TTTATATTCCAACATCAAACGTCAACAAAGCTTGAGAGTTTTGA
back to top