DN135240

Overview
NameDN135240
Unique NameDN135240
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length116
Libraries
Library NameType
Mature Juice Sac from Navel Orange in Vulnus5 vectorcdna_library
Properties
Property NameValue
Genbank descriptionwca08d05 Mature Juice Sac from Navel Orange in Vulnus5 vector Citrus sinensis cDNA clone wca08d05 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN135240 ID=DN135240|Name=DN135240|organism=Citrus sinensis|type=EST|length=116bp
AATACCAAGTACAAATAACAAAAGCAGTTACTNNNCCCCTTAAACACTTC
TTTAATCAAAGTTCTTGTTTTTTTGACTCTAAATTATATTTTATTCCATT
TTACCCTTTTTAAGAA
back to top