DT214561

Overview
NameDT214561
Unique NameDT214561
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length137
Properties
Property NameValue
Genbank descriptionUCRCS10_1E05_b2 Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10-2 Citrus sinensis cDNA clone UCRCS10-1E05-I9-5.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214561 ID=DT214561|Name=DT214561|organism=Citrus sinensis|type=EST|length=137bp
AGAAAATTACACCAAATTTCTCCATCCCCACGATATTTAGTGCCCTAAGG
GGGTTACAATTTTTATTTTTTTTGGGTTTATTGCCTATTTTGAATTNTNA
TNAAAATGTANATAATTATNAGATTTTATAATTTTTA
back to top