DT214557

Overview
NameDT214557
Unique NameDT214557
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length264
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS10_14H04_b2 Madame Vinous Sweet Orange Multiple Pathogen-Infected cDNA Library UCRCS10-2 Citrus sinensis cDNA clone UCRCS10-14H04-O8-6.d-polyt, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DT214557 ID=DT214557|Name=DT214557|organism=Citrus sinensis|type=EST|length=264bp
ATCTGGACACTGGCTTTGATGATTGAGAACCAGAAGGCTTTGATGTGTTC
CTGATTTGTTCCTGCTGATCTGTTTGCAGATTATATTTGTGCTCTATGAT
CGATTCTGTAAAAGCCTTGTAACAATCAAATTCTGGCTTTGAAGCCTGGG
CAGATATCTCCTGAATTGTTAAAGGTGCTGTTGCAACATTATCTTCTTTA
AAAATTACTAAGGCCTTCTCAGCAGAATTAGCTTCCACATTAACATTAGT
TACCAAACTTTTGG
back to top