CX294950

Overview
NameCX294950
Unique NameCX294950
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length711
Libraries
Library NameType
DroRLeaf1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
CX294950_ssr29 microsatellite CX294950_ssr29:29..43. BLAST: Citrus ESTs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC05065A01SK DroRLeaf1 Citrus clementina cDNA clone C05065A01, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX294950 ID=CX294950|Name=CX294950|organism=Citrus clementina|type=EST|length=711bp
TCTCTAAGCCCTCATCACTGTCTCTTCCCTTCTCTTCTCTTCTATCCGTA
GCTGCAGAAATACCAAAACGAAACTAACTTTCAGTATTCAGCGTGACTAT
AACTCGGATATACTTTAAAGATGTCTGTGTCTGGATTGATTGGTAGTCCC
TCAAGATGTTGTCTCAGGATACCTGTTTGCAGTTCTGGTTCAGTGAGGCG
ATTTTCAGCTTTTACTAGCCCTGGGAAACCCAAGGACCAAATCAAAATCG
CTTACCTGGAAAGATGGTACTGGGCTGGTTCTGCACAAGGATGCAAGAAG
CAAAGAACTTACTCGATCAAGTGTGCGATGGATGCTTCCTATGGTGATAT
GTCAGATGGATCAACAGCTATCTTCCCTAGAATTAATGTGCGGGATCCAT
ATAAAAGACTTGGAATTAGCAGGGAAGCTTCTGAAGAAGAAATTCAAGCC
GCGAGGAACTTCCTTGTTCAGAAATATGCAGGGCACAAACCAAGTATAGA
TGCAATTGAATCTGCCCATGACAAAATAATAATGCAGAAGTTCTATGAAA
GGAGGAACCCAAAAATTGACATCAAGAAAAAGGTTAGGGAAGTCCGTCAG
TCTCGTGTTATGCAGGCTGTCATGAGCAGGTTCCAAACACCATCTACTAA
GATCATCATAAAAACTTCCGTTGCATTTCTAGTGATTGGAGTTCTCACTG
TTCTCTTTCCA
back to top