CX308547

Overview
NameCX308547
Unique NameCX308547
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length663
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21001B10Rv AbsLeaSub1 Citrus clementina cDNA clone C21001B10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308547 ID=CX308547|Name=CX308547|organism=Citrus clementina|type=EST|length=663bp
AAGTGGCCCCTCTAGAGGTAGCTCCAGTCATCGCAGGTTAGTAGTGTTTA
TTTCCATGTAATTTACGTCAGTTCTGTTGAATGATAACTTATTAGAACTA
TTAGTTGGAAATTCGTTTTTCTAATTATATAGTGATCCACTGAAAGGGGA
ATCTAACTTTCATAGGTTTATACATTTTAACTTGCCTTCTACAATCTTTG
AATCAACTTCTGATTGGATTAGTTTCCATGGCCTAGGCGATTTTCTCAGA
GTTCAATGTGTATCAAACTAAGGATTTATACGAAGCTAGTTTCTTTTGAT
TGATGTTTCTAGATTCCCCAAAATATTATTTTCAGCTTATTAGTTCCATT
GACTCATGATCTGTATAATTTGATGCATGGTCTTCCTGTATTTCACAGTT
CCCGGAGACGCCGTTCCCGCTTCTATGATAATTAGAAAGTGGAAGCAAAT
GATCGAAAGAACTGGGTTAGAGATGATGGTGATAGATGGGAAGTGGAAAG
CAGTCAAATCACTGGGGTTGCGAGGTCATTAGCATTCAAACATGTAAAAG
CTACATGTGTGTTATAATTCTGTTACATATTTTGTGCTGGTTATACATAA
GTTTCAAACTGTAGAATCCCAAGTGGTAATATGCGCCGACCACTACTTTA
TGTTATGAAGCAG
back to top